Photos / Sounds

What

Horseshoe Bats (Genus Rhinolophus)

Observer

dolzhanskiy

Date

December 27, 2014 11:52 PM EAT
Horseshoe Bats - Photo (c) Ján Svetlík, some rights reserved (CC BY-NC-ND)
jakob's ID: Horseshoe Bats (Genus Rhinolophus)
Added on July 19, 2024
Supporting

Photos / Sounds

What

Yellow-winged Bat (Lavia frons)

Observer

hafiz_a_a

Date

June 22, 2024 09:41 AM WAT
Yellow-winged Bat - Photo (c) Oleg Chernyshov, some rights reserved (CC BY), uploaded by Oleg Chernyshov
jakob's ID: Yellow-winged Bat (Lavia frons)
Added on July 17, 2024
Supporting

Photos / Sounds

What

Bats (Order Chiroptera)

Observer

mathias_dezetter

Date

July 17, 2024 12:06 PM GMT
Free-tailed Bats - Photo (c) Chien Lee, all rights reserved, uploaded by Chien Lee
jakob's ID: Free-tailed Bats (Family Molossidae)
Added on July 17, 2024
Leading

Photos / Sounds

What

Angolan Soft-furred Fruit Bat (Myonycteris angolensis)

Observer

zhou_fangyi

Date

June 23, 2024 09:50 PM EAT
Collared Fruit Bats - Photo (c) Jakob Fahr, some rights reserved (CC BY-NC), uploaded by Jakob Fahr
jakob's ID: Collared Fruit Bats (Genus Myonycteris)
Added on July 17, 2024
Improving

Photos / Sounds

What

Vesper Bats (Subfamily Vespertilioninae)

Observer

claudiakzn

Date

July 17, 2024 08:53 AM SAST
Vesper Bats - Photo (c) Jose G. Martinez-Fonseca, all rights reserved
jakob's ID: Vesper Bats (Subfamily Vespertilioninae)
Added on July 17, 2024
Leading

Photos / Sounds

What

Peter's Dwarf Epauletted Fruit Bat (Epomophorus pusillus)

Observer

joao_miguel

Date

November 27, 2023 08:08 PM GMT
Peter's Dwarf Epauletted Fruit Bat - Photo (c) Martin Farrell, all rights reserved
jakob's ID: Peter's Dwarf Epauletted Fruit Bat (Epomophorus pusillus)
Added on July 17, 2024
Improving

Photos / Sounds

What

Gambian Epauletted Fruit Bat (Epomophorus gambianus)

Observer

sadamtoro

Date

May 1, 2024 12:29 PM WAT
Gambian Epauletted Fruit Bat - Photo (c) Jakob Fahr, some rights reserved (CC BY-NC), uploaded by Jakob Fahr
jakob's ID: Gambian Epauletted Fruit Bat (Epomophorus gambianus)
Added on July 17, 2024
Leading

Photos / Sounds

What

Angolan Soft-furred Fruit Bat (Myonycteris angolensis)

Observer

globalherping

Date

November 2020

Place

Tanzania (Google, OSM)
Angolan Soft-furred Fruit Bat - Photo (c) Cody Baldwin, some rights reserved (CC BY-NC-ND), uploaded by Cody Baldwin
jakob's ID: Angolan Soft-furred Fruit Bat (Myonycteris angolensis)
Added on July 17, 2024
Improving

Photos / Sounds

What

Horseshoe Bats (Genus Rhinolophus)

Observer

globalherping

Date

November 2020

Place

Tanzania (Google, OSM)
Horseshoe Bats - Photo (c) Ján Svetlík, some rights reserved (CC BY-NC-ND)
jakob's ID: Horseshoe Bats (Genus Rhinolophus)
Added on July 17, 2024
Supporting

Photos / Sounds

What

Horseshoe Bats (Genus Rhinolophus)

Observer

globalherping

Date

November 2020

Place

Tanzania (Google, OSM)
Horseshoe Bats - Photo (c) Ján Svetlík, some rights reserved (CC BY-NC-ND)
jakob's ID: Horseshoe Bats (Genus Rhinolophus)
Added on July 17, 2024
Supporting

Photos / Sounds

What

Straw-coloured Fruit Bat (Eidolon helvum)

Observer

lesserspotted

Place

Rwanda (Google, OSM)
Straw-coloured Fruit Bat - Photo (c) Klipdrifters Travel, some rights reserved (CC BY-NC), uploaded by Klipdrifters Travel
jakob's ID: Straw-coloured Fruit Bat (Eidolon helvum)
Added on July 17, 2024
Supporting

Photos / Sounds

What

Gambian Epauletted Fruit Bat (Epomophorus gambianus)

Observer

paulkingsnorth

Date

December 6, 2018 10:22 AM GMT
Gambian Epauletted Fruit Bat - Photo (c) Jakob Fahr, some rights reserved (CC BY-NC), uploaded by Jakob Fahr
jakob's ID: Gambian Epauletted Fruit Bat (Epomophorus gambianus)
Added on July 17, 2024
Supporting

Photos / Sounds

What

Yellow-winged Bat (Lavia frons)

Observer

lesserspotted

Date

May 17, 2009 08:48 AM EAT
Yellow-winged Bat - Photo (c) Oleg Chernyshov, some rights reserved (CC BY), uploaded by Oleg Chernyshov
jakob's ID: Yellow-winged Bat (Lavia frons)
Added on July 17, 2024
Supporting

Photos / Sounds

What

Gambian Epauletted Fruit Bat (Epomophorus gambianus)

Observer

gavinailes

Date

April 8, 2024 07:18 PM GMT
Gambian Epauletted Fruit Bat - Photo (c) Jakob Fahr, some rights reserved (CC BY-NC), uploaded by Jakob Fahr
jakob's ID: Gambian Epauletted Fruit Bat (Epomophorus gambianus)
Added on July 17, 2024
Supporting

Photos / Sounds

What

Epauletted Fruit Bats (Genus Epomophorus)

Observer

henry180

Date

October 14, 2022 01:09 PM SAST
Epauletted Fruit Bats - Photo (c) Jakob Fahr, some rights reserved (CC BY-NC), uploaded by Jakob Fahr
jakob's ID: Epauletted Fruit Bats (Genus Epomophorus)
Added on July 17, 2024
Improving

Photos / Sounds

What

Mauritius Flying-Fox (Pteropus niger)

Observer

fabiocianferoni

Date

June 2024

Place

Missing Location
Mauritius Flying-Fox - Photo (c) Eliane Küpfer, some rights reserved (CC BY-NC), uploaded by Eliane Küpfer
jakob's ID: Mauritius Flying-Fox (Pteropus niger)
Added on July 17, 2024
Supporting

Photos / Sounds

Observer

luckylukar

Date

October 10, 2021 01:59 PM +04
Pteropus seychellensis seychellensis - Photo (c) uncoyote, some rights reserved (CC BY-NC-SA)
jakob's ID: Pteropus seychellensis ssp. seychellensis, a member of Seychelles Flying-Fox (Pteropus seychellensis)
Added on July 14, 2024
Supporting

Photos / Sounds

What

Mauritius Flying-Fox (Pteropus niger)

Date

August 2019

Place

Missing Location
Mauritius Flying-Fox - Photo (c) Eliane Küpfer, some rights reserved (CC BY-NC), uploaded by Eliane Küpfer
jakob's ID: Mauritius Flying-Fox (Pteropus niger)
Added on July 14, 2024
Improving

Photos / Sounds

What

Mauritius Flying-Fox (Pteropus niger)

Observer

fabiocianferoni

Date

June 2024

Place

Missing Location
Mauritius Flying-Fox - Photo (c) Eliane Küpfer, some rights reserved (CC BY-NC), uploaded by Eliane Küpfer
jakob's ID: Mauritius Flying-Fox (Pteropus niger)
Added on July 14, 2024
Leading

Photos / Sounds

What

Vesper Bats (Subfamily Vespertilioninae)

Observer

thoriso

Date

July 13, 2024 03:52 PM SAST
Vesper Bats - Photo (c) Jose G. Martinez-Fonseca, all rights reserved
jakob's ID: Vesper Bats (Subfamily Vespertilioninae)
Added on July 14, 2024
Leading

Photos / Sounds

What

Peter's Dwarf Epauletted Fruit Bat (Epomophorus pusillus)

Observer

jacksutton

Date

July 12, 2024 09:26 PM EAT

Description

Ajai

Peter's Dwarf Epauletted Fruit Bat - Photo (c) Martin Farrell, all rights reserved
jakob's ID: Peter's Dwarf Epauletted Fruit Bat (Epomophorus pusillus)
Added on July 14, 2024
Supporting

Photos / Sounds

What

Egyptian Free-tailed Bat (Tadarida aegyptiaca)

Observer

kinajoubert

Date

February 22, 2024 08:36 AM SAST
Egyptian Free-tailed Bat - Photo (c) gdevender, some rights reserved (CC BY-NC), uploaded by gdevender
jakob's ID: Egyptian Free-tailed Bat (Tadarida aegyptiaca)
Added on July 14, 2024
Supporting

Photos / Sounds

What

Straw-coloured Fruit Bat (Eidolon helvum)

Observer

m107791

Date

June 2024

Place

Missing Location

Description

Lunch stop at Travellers Rest Hotel. Hundreds of fruit bats hanging from the trees !

Straw-coloured Fruit Bat - Photo (c) Klipdrifters Travel, some rights reserved (CC BY-NC), uploaded by Klipdrifters Travel
jakob's ID: Straw-coloured Fruit Bat (Eidolon helvum)
Added on July 14, 2024
Supporting

Photos / Sounds

What

Epauletted Fruit Bats (Genus Epomophorus)

Observer

liam_pentangelo

Date

June 13, 2024 01:48 AM SAST
Epauletted Fruit Bats - Photo (c) Jakob Fahr, some rights reserved (CC BY-NC), uploaded by Jakob Fahr
jakob's ID: Epauletted Fruit Bats (Genus Epomophorus)
Added on July 14, 2024
Supporting

Photos / Sounds

What

Epauletted Fruit Bats (Genus Epomophorus)

Observer

liam_pentangelo

Date

June 13, 2024 01:48 AM SAST
Epauletted Fruit Bats - Photo (c) Jakob Fahr, some rights reserved (CC BY-NC), uploaded by Jakob Fahr
jakob's ID: Epauletted Fruit Bats (Genus Epomophorus)
Added on July 14, 2024
Supporting

Photos / Sounds

What

Gerbe's Vole (Microtus pyrenaicus)

Observer

sven_gippner

Date

May 25, 2024 08:59 AM CEST

Description

MVTIS 34742

CytB sequence:
GGACTAAACTCAGACGCAGACAAAATCCCATTCCACCCCTATTATACAGTCAAAGACTTCCTAGGGGTCCTTATCCTATTAATAGCTTTCATAATTTTAACTTTATTTTTCCCAGATATTCTCGGAGACCCCGACAATTACACCCCTGCAAATCCACTCAACACTCCACCACACATTAAACCAGAATGGTATTTTCTTTTCGCCTACGCCATTCTACGATCCATCCCTAACAAACTAGGAGGTGTACTAGCACTAATCTTATCAATCCTAATCTTAGCCTTCATACCATTACT

Gerbe's Vole - Photo (c) Cesar Pollo, some rights reserved (CC BY-NC), uploaded by Cesar Pollo
jakob's ID: Gerbe's Vole (Microtus pyrenaicus)
Added on July 14, 2024
Supporting

Photos / Sounds

What

Gerbe's Vole (Microtus pyrenaicus)

Observer

sven_gippner

Date

May 31, 2024 01:46 PM CEST

Description

MVTIS 34750

CytB-sequence:
CACGATTCTTCGCCTTCCACTTCATCCTACCCTTTATCATTACCGCCCTTGTACTAGTCCATCTACTATTCTTACACGAAACAGGATCCAACAACCCAACCGGACTAAACTCAGACGCAGACAAAATCCCATTCCACCCCTATTATACAGTCAAAGACTTCCTAGGGGTCCTTGTCCTATTAATAGCTTTCATAATTTTAACTTTATTTTTCCCAGATATTCTCGGAGACCCCGACAATTACACCCCTGCAAATCCACTCAACACTCCACCACACATTAAGCCAGAATGGTATTTTCTTTTCGCCTACGCCATTCTACGATCCATCCCTAACAAACTAGGAGGTGTACTAGCACTAATCTTATCAATCCTAATCTTAGCCTTCATACCATTACTCCATACCTCAAAACAACGAGCACTCACTTTCCGCCCAATCACAC

Gerbe's Vole - Photo (c) Cesar Pollo, some rights reserved (CC BY-NC), uploaded by Cesar Pollo
jakob's ID: Gerbe's Vole (Microtus pyrenaicus)
Added on July 14, 2024
Supporting

Photos / Sounds

What

Gerbe's Vole (Microtus pyrenaicus)

Observer

sven_gippner

Date

May 29, 2024 08:50 AM CEST

Description

MVTIS 37716

CytB sequence:
CCTAGCCATACACTACACATCAGACACAGCAACAGCATTCTCATCAGTAGCCCACATCTGCCGAGACGTAAACTACGGCTGACTAATCCGATATATACATGCTAACGGCGCTTCAATATTTTTCATTTGCCTATTCCTACATGTAGGACGAGGGGTTTACTACGGCTCCTACAACATAATCGAAACATGAAACATAGGAATTATCTTACTATTCGCCGTAATAGCGACAGCATTCATAGGCTACGTACTACCATGAGGCCAAATATCATTCTGAGGAGCCACAGTCATTACAAACCTCCTATCAGCCATCCCTTACATCGGAACCACACTAGTAGAATGAATCTGAGGCGGATTCTCAGTAGACAAAGCCACCCTTACACGATTCTTCGCCTTCCACTTCATCCTACCCTTTATCATTACCGCCCTTGTATTAGTCCATCTACTATTCTTACACGAAACAGGATCCAACAACCCAACCGGACTAAACTCAGACGCAGACAAAATCCCATTCCACCCCTATTATACAGTCAAAGACTTCCTAGGGGTCCTTATCCTATTAATAGCTTTCATAATTTTAACTTTATTTTTCCCAGATATTCTCGGAGACCCCGACAATTACACCCCTGCAAATCCACTCAACACTCCACCACACATTAAACCAGAATGGTATTTTCTTTTCGCCTACGCCATTCTACGATCCATCCCTAACAAACTAGGAGGTGTACTAGCACTAATCTTATCAATCCTAATCTTAGCCCTCATACCATTACTACACACCTCAAAACAACGAGCACTCACTTTCCGCCCAATCACACAAACAATATACTGAATCCTAGTAGCCG

Gerbe's Vole - Photo (c) Cesar Pollo, some rights reserved (CC BY-NC), uploaded by Cesar Pollo
jakob's ID: Gerbe's Vole (Microtus pyrenaicus)
Added on July 14, 2024
Supporting

Photos / Sounds

Observer

upupa_epops

Date

August 8, 2015 05:31 PM SAST
Utricularia × neglecta - Photo (c) roman_romanov, some rights reserved (CC BY-NC), uploaded by roman_romanov
jakob's ID: Utricularia × neglecta, a member of Section Utricularia (Section Utricularia)
Added on July 13, 2024
Supporting
Added as part of a taxon split

Photos / Sounds

Observer

jeremybarker

Date

June 8, 2018 08:23 AM CEST
Utricularia × neglecta - Photo (c) roman_romanov, some rights reserved (CC BY-NC), uploaded by roman_romanov
jakob's ID: Utricularia × neglecta, a member of Section Utricularia (Section Utricularia)
Added on July 13, 2024
Supporting
Added as part of a taxon split

Stats

  • 200124