Last record at Jamaica Bay -- 20 years ago. And it looks like the first United States record entered into INat.
Debbie Klein collection.
ITS1 sequence:
TATGATATGCTTAAGTTCAGCGGGTAGTCCTACCTGATTTGAGGTCAAATTGTCATTATGTGCTGTCCGAATAAACGGAC
GGTTAGAAGCAGCTTCAACCCATTGAGAGCAGACGTCCACGGCGTAGATAATTATCACACCAATAGACGGTCCACAGCGG
GCAGCCGGCTAATGCATTTAAGGGGAGCTGACATCTCAAGAGAAGCCGGCAAAATACCCCCAAGTCCAAGCCATTACACA
AGCTAACAAAAGCTGGTAAGGTTGAGAATTTAATGACACTCAAACAGGCATGCTCCTCGGAATACCAAGGAGCGCAAGGT
GCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGA
GAGCCAAGAGATCCGTTGCTGAAAGTTGTATATAGTTTATAGGCATAAAGCCATAAGAAACATTCTGTTACATTCTTTGG
GGTATATGAAAACGTAGAGCGCCGAAAAAACCTTCAACTTGAAGGACAAGTCCCTCTCCTATCCAGTTCCAACGTCTACA
AAAGGTGCACAGGTGGAGATATAAAGATGACGGGCGAGCACATGCCCCCGAGAGGACCAGCTACAACCACGCCAAAGTTA
TTCAATAATGATCCTCCGCAGGTCACCTACG
Aluminum can for size comparison. A little smaller than a dime I’d say.
It’s on a peanut butter Cassia (aka Mursik) tree
slow worm
Blindschleiche
șopârlă apodă
This is the Outramps CREW 100,000 obs and we celebrated it with Tilla who is the Head of the Threatened Plants Programme and the CREW Programme. It represents our involvement with plant monitoring from 1992 to 2021. It has been a joyous ride. So thank you all for so many years of fun, laughs and learning. Keep going!
habitat self-evident
Photo taken by Derek Odendaal of the HAT of the MCSA/Outramps. His description - Altitude 1298 m. The site is about 60 m west of the summit beacon. It is rather flat with sedges, short grass, many Watsonias and some Mimetes. A community of about 10 plants in close proximity. I looked out for more of these plant when going down (northern slope), but saw none. The plant is low growing, about 300 mm high with dense stems. The stems with leaves are between 10 and 12 mm in diameter and rather firm.
Impossible de le photographier en entier. Il se faufilait entre les rochers et la végétation. Observé en bord de mer, sur les rochers
Another beauty I was delighted to see. Not uncommon like Babakina, but something I've wanted to behold for some time. Wish I'd tried to clean up the water a bit. Guess I'll have to go back and find another. Interesting fact: while this is not technically a nudibranch, it does eat nudibranchs.
Only a few of these were blooming (literally 10 out of 100,000 plants I saw) - I think it was because they were alongside a road with some construction going on - probably resulting in a bit of water spraying and runoff which kicked these into flowering mode?
medicine
Kingsley school visit
Native oyster found on Kanuka in a podocarp forest.
I put my hand on a tree to move through the bush it was on the other side. Pulled my hand away quickly thinking it was a creepy insect. Went round the back and found this
Spores of this growing here:
https://inaturalist.nz/observations/21700774
I managed to get these spores fruiting again and wow they taste good! https://inaturalist.nz/observations/31540368
Pictures 1, 2: From this morning. After taking them I put an index card under it hoping I could obtain a spore print without having to cut it down, but it didn’t seem to work.
Pictures 3-5: From tonight when I went to go check on it. Will update with a spore print
Pictures 6-8: From yesterday
Picture 9: From 2 days ago
Pictures 10-12: From 3 days ago
Pictures 13, 14: From 4 days ago
Picture 15: 5 days ago
Picture 16: 6 days ago
Picture 17: 7 days ago when I first noticed it
• Stem is hollow
This poor thing. It was the only flower blooming in the entire field and this bee found it and had a field day. I watched it for about 10 minutes as it completely covered itself in pollen. And then I watched it get out and fly directly into a spider trap. After a few excruciating minutes of watching it struggle w no spider in sight, I decided to interfere and helped it out, srry nature
Can I eat it tho? Found in CV by a tree
After doing some research I think it’s a Shaggy Mane and it is edible. The only mushroom it is sometimes confused with is the somewhat poisonous Scaly Ink Cap. Or possibly the poisonous Alcohol Inky
First time it's appeared in our neighborhood
There were a lot of these, just off of the road in highly compacted soil under blue gum eucalyptus trees.
Several patches of this unusual mushroom were found growing in a woodchip filled garden bed.
Cross section with swiss army knife
growing in partial shade on moist soil near trees, on a steep north-facing slope
www.mushroomexpert.com/coprinus_comatus.html
Is it a fish? Is it a slug? Is it a fishy anemone? I do not have a clue what this is!
It is about 30mm long and there were a few of them in the sand - outgoing tide nearly on the turn. Most were buried and only the "fan fin" was showing.
Resting on the wet sand, when the sand collapsed it arched it's face upwards (2nd and third photos) and seem to spawn capsule from somewhere - there are 2 floating in the 4th pic.
Totally hypnotic, by the time my sister-in-law and I carried on the brother had walked 2kms away from us!
The flower is trumpet shaped and pink/purple and fades darker inside. The outside of the flowers are creamy white. The bottom of the flowers looks and feels like Chinese Cabbage as it's thick and watery. The green leaves are large and most of them are bigger than my hand. The leaves are heart-shaped and longer in the middle.
Seen near boardwalk at San Joaquin Wildlife Santuary in Irvine, California