Icon
Photos / Sounds
Species / Taxon Name
Observer
Place
Actions

Photos / Sounds

Observer

awenninger

Date

September 23, 2020 05:27 PM AKDT

Photos / Sounds

No photos or sounds

Observer

awenninger

Date

August 5, 2020 12:08 PM AKDT

Description

Sent in a leafmining moth to LifeScanner but it must have been contaminated, the ID came back as Chaitophorus populifolii. Host was balsam poplar. BOLD-DJ4, DNA sequence: COI-5P
AACTTTATATTTTTTATTCGGAATCTGATCAGGAATAATTGGATCTTCATTAAGAATTTTAATTCGATTAGAACTTAGACAAATTAATTCAATTANTAATAATAATCAATTATATAATGTTATTGTAACAATTCATGCATTTATTATAATTTTCTTTATAACAATACCTATCGTAATTGGAGGATTCGGAAATTGATTAATTCCTATAATAATAGGATGTCCTGACATATCATTTCCACGTTTAAATAATATTAGATTTTGAATATTACCACCCTCCCTAATAATAATAATTACAAGATTTATAATTAATAATGGAACAGGAACAGGATGAACAATTTATCCCCCATTATCAAATAATATTGCCCACAATAATATTTCAGTTGATCTAACTATTTTTTCATTACATTTAGCAGGAGTATCTTCTATTTTAGGAGCAATTAATTTTATTTGCACTATCTTAAATATAATACCCAATAACATAAAACTTAATCAAATCCCCCTTTTCCCTTGATCTATTTTAATTACAGCAATCTTATTAATCCTTTCATTACCTGTATTAGCAGGTGNTATTACAATACTATTAACTGATCGAAACCTAAATACTTCATTTTTCG-

Link to observation of leaf/mine from leafminer I had sent in: https://www.inaturalist.org/observations/55720746

Photos / Sounds

What

Auger Beetles Family Bostrichidae

Observer

awenninger

Date

September 17, 2020 07:22 PM AKDT

Description

Found in brown rice

Photos / Sounds

Square

Observer

awenninger

Date

June 10, 2020 11:25 AM AKDT

Description

Host: Betula neoalaskana. Family ID from LifeScanner. Vial BOLD-GE8. DNA sequence: COI-5P
TATTTTTGGTATTTGATCAGGAATAGTAGGAACTTCTTTAAGAATTTTAATTCGATCAGAATTAGGTAACCCTGGTTCATTAATTGGAGATGACCAAATTTATAATGTAATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCAATTATAATTGGAGGTTTTGGAAATTGATTAGTACCTTTAATATTAGGAGCCCCAGATATAGCTTTCCCACGACTTAATAATATAAGATTTTGATTATTACCTCCATCATTAACTTTATTAATTTCTAGAAGATTTGTAGAAAACGGAGCAGGAACTGGGTGAACAGTATACCCTCCTTTATCTTCTAATATTGCCCATGCGGGCAGTTCTGTTGACTTAGCAATTTTTTCATTACATTTAGCTGGAATTTCATCTATTTTAGGGGCTGTTAATTTTATTACAACAGTAATTAATATGCGACCCTATGGAATAAGATTAGATCGAATACCATTATTTGTTTGAGCTGTAGCCATTACTGCTTTATTACTACTTTTATCTTTACCTGTATTAGCTGGAGCAATTACTATATTATTAACAGATCGAAATTTAAATACATCATTTTTCGACCCTGCAGGAATAAGA-----------------

Photos / Sounds

Square

Observer

awenninger

Date

June 10, 2020 08:28 AM AKDT

Description

Host: Betula neoalaskana. Family ID from lifescanner. Lifescanner vial BOLD-ZR6. DNA sequence: COI-5P
GAAATTGATTAGTACCTTTAATATTAGGGGCCCCAGATATAGCTTTCCCACGACTTAATAATATAAGATTTTGATTATTACCTCCATCATTAACTTTATTAATTTCTAGAAGATTTGTAGAAAACGGAGCAGGAACTGGGTGAACAGTATACCCTCCTTTATCTTCTAATATTGCCCATGCGGGGAGTTCTGTTGACTTAGCAATTTTTTCATTACATTTAGCTGGAATTTCATCTATTTTAGGGGCTGTTAATTTTATTACAACAGTAATTAATATGCGACCCTATGGAATAAGATTAGATCGAATACCATTATTTGTTTGAGCTGTAGCCATTACTGCTTTATTACTACTTTTATCTTTACCTGTATTAGCTGGAGCAATTACTATATTATTAACAGATCGAAATTTAAATACATCA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------

Photos / Sounds

What

Rain-Beetle Pterostichus melanarius

Observer

awenninger

Date

September 16, 2020 03:56 PM AKDT

Photos / Sounds

What

Rusty Tussock Moth Orgyia antiqua

Observer

awenninger

Date

September 16, 2020 04:35 PM AKDT

Photos / Sounds

What

Webcaps Genus Cortinarius

Observer

awenninger

Date

September 10, 2020 10:06 AM AKDT

Photos / Sounds

Square

What

Ichneumonid and Braconid Wasps Superfamily Ichneumonoidea

Observer

awenninger

Date

September 10, 2020 11:58 AM AKDT

Photos / Sounds

What

Ichneumonid Wasps Family Ichneumonidae

Observer

awenninger

Date

September 10, 2020 11:57 AM AKDT

Photos / Sounds

Square

What

Alder Sawfly Eriocampa ovata

Observer

awenninger

Date

September 10, 2020 12:30 PM AKDT

Photos / Sounds

What

Shingled Hedgehog Sarcodon imbricatus

Observer

awenninger

Date

September 10, 2020 10:06 AM AKDT

Photos / Sounds

What

Varied Thrush Ixoreus naevius

Observer

awenninger

Date

September 10, 2020 12:07 PM AKDT

Description

Found dead

Photos / Sounds

Observer

awenninger

Date

September 10, 2020 01:43 PM AKDT

Photos / Sounds

Observer

awenninger

Date

September 10, 2020 01:41 PM AKDT

Photos / Sounds

What

Truncated Club Clavariadelphus truncatus

Observer

awenninger

Date

September 10, 2020 01:41 PM AKDT

Photos / Sounds

What

Purple Spindles Alloclavaria purpurea

Observer

awenninger

Date

September 10, 2020 01:13 PM AKDT

Photos / Sounds

Observer

awenninger

Date

September 9, 2020 07:52 PM AKDT

Photos / Sounds

Observer

awenninger

Date

September 9, 2020 07:54 PM AKDT

Photos / Sounds

What

Cavaliers Genus Melanoleuca

Observer

awenninger

Date

September 5, 2020 06:31 PM AKDT

Photos / Sounds

Square

What

Battered Sallow Sunira verberata

Observer

awenninger

Date

August 31, 2020 06:12 PM AKDT

Photos / Sounds

Square

What

Rusty Tussock Moth Orgyia antiqua

Observer

awenninger

Date

September 1, 2020 09:26 AM AKDT

Photos / Sounds

What

Rusty Tussock Moth Orgyia antiqua

Observer

awenninger

Date

August 31, 2020 07:55 PM AKDT
Birds

Photos / Sounds

Square

What

Birds Class Aves

Observer

awenninger

Date

August 31, 2020 02:50 PM AKDT

Photos / Sounds

Observer

awenninger

Date

August 31, 2020 02:22 PM AKDT

Description

On Sitka or Siberian alder

Photos / Sounds

Square

What

Candy Lichen Icmadophila ericetorum

Observer

awenninger

Date

August 31, 2020 02:09 PM AKDT

Photos / Sounds

Observer

awenninger

Date

August 31, 2020 01:34 PM AKDT

Description

On sitka or Siberian alder

Photos / Sounds

Square

What

Rusty Tussock Moth Orgyia antiqua

Observer

awenninger

Date

September 1, 2020 09:27 AM AKDT

Photos / Sounds

Square

What

Rusty Tussock Moth Orgyia antiqua

Observer

awenninger

Date

September 1, 2020 09:28 AM AKDT

Photos / Sounds

Square

What

Witch's Butter Tremella mesenterica

Observer

awenninger

Date

September 1, 2020 10:05 AM AKDT

Description

On alder

Feeds: Atom